Table 5.

Promoters from the Rhodobacter group of the alpha Proteobacteria

Strain/promoteraPromoter regionbReference(s)
Ec/consensusaTTGACA N15–19TATAAT120
Group A
Rc/bchCATCAAATTGACAGTCGGGCGTGTAAGTTCAATGATACACACAGG54
 Rs/groECCCCCGTTGACAGGTGCCGGACGCTCTCATATCTCTCGCGTCG166
 Pd/qoxA*TTGACCTAGATCAAGGTAATTCACCCCGCCATGTTGC346
 Rc/radCGAGATCTTGACGAGGCGCAGCCGGTTGCCGTCTCTTCCGACC197
 Rs/trxAGACAACTTGACGCGGCAGGGGGCCATCCTTACTTTCCAAGCA222
 Rc/recAATTTGATTGCAATGTTCCGCAATTGTACTTCATACCATGAGAA76
 Rc/cpeAATGCAATTGGAATTTATCAAAATCGCCTTCTAGTTTCAATCGC81
 Rc/pucTTACACTTGATCGCCGACACTTGGGCTCCCATAGTGCGTCTCA54
 Rc/fdxACTGCTCTTGATTGATCGCCCCCGGAGGGCTAGGACATCCC72, 248
 Rc/atpHTGGTTGCGAGGGTCTTGATGCTCTGCTAGACGCAACCCCCGA31
 Rs/hupSTTCTCATTGGCGGAAACCGGCCCAACCATGAGAATTCCACTCTA288
 Rs/coxIITTTTCCTTGTCGTCGCCAAAACAATATGGTCTCAATCGGTTCA79
 Rc/lepBTTGACTTGCCCCCCGCATCGGCCAAGGAAGACAAGGTTTCAAC154
 Rc/dnaKCAGTTCTTGCAGGGCTATTTTCCCCTCCTTATATACGCCGG198
 Rs/rrnBATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAACCGCTTC71
 Rs/rrnATTCCTCTTGCGGGTTTTTTTGCGGTTCCCTAGATAGCGCCTC71
 Rs/rrnCTTCCTCTTGCGGGTTTTTTTGCGGTTCCCTAGATAGCGCCTC71
 Rc/rpoDTTTGATTCGCCCCTGTGATTCGCCGCCGTGATTCGATAAAAC223
Group B
 Pd/sdhCATGTGATCACAGCTGCCGTTTGCGTGATCACAAAAATGGAAA69
 Rc/porAGGCCGCTTCGGTCCCGTTTTCGTTGCAATATGAGGCGTGG289
 Rs/cycFTTCCAGTATGTCTGTCGCGACCGGCGGGCTAGATTTCCGGGA79, 80
 Rs/norCCCCGCAACCTCTCCGGCGCCGGCGCGGGCTAGAGGAGGTCCA7
 Pd/ctaC*GATAGGTATGGCTTGCCGCCGGGGTAAGATATGGTTCTGGTG277
 Pd/fbc* CCGCTGGACTGACGGGGATTTGATCGCTAGAACCGCGC277
 Pd/porG* ATGCGGGGGGGAAAGCGCGACACCACTTGCATACCCCAAAC254
 Rc/pufGCTCTGGACCGGATCGTGTCGCAACACCCGGTTCTGACACGGA11
 Rc/pufQ CGCGCGACGGGCACCCCCTTCATGGTTACATGGGTA54
 Rs/chrR1GCCTGATCCAGACTGGCCCGGCCGCCGTAAGAAGGACGTTA257
 Rs/chrR2GCGGATGCAAGCCGGGGGAGGGTTTCCTATCTTCACCTCCGG257
 Rc/cycAATATGCGACCTTTTGCCTTGTGGTAAAGCGTGGACCG54, 70
 Pd/pazSTTCTCAAGCCGAATGCCCTGTACCGGACCTAAACCAGGCACG168
Group C
 Pd/cycA1CCTGTATTCTGCCCGCTTGGCACATGATAGCCCTGTCAATCG279
 Pd/cycA2TCTGCCCGCTTGGCACATGATAGCCCTGTCAATCGGGAAGCG279
 Rc/fruB TTTCGCGCGCGAACTCTGCCCCATGGGCGATGGCCG54
 Rc/xdhATTCAACGCGCCGCGGGCCGAAATCCTTGCCAGCGCCAAAGCC167
 Rs/crtAGGGCGGACATTAGTCGCGAAGTCGCACCGCCCTCAAGCCGCA164
 Rs/ctaDGGAACAAGACCGGCGTCTACAGATATCCGGGAGATGCTGGCA79
 Rs/cycACCGGAACGCGCGGCCCGCAGTAGTGATTGTGTGCCGGCGGCA70
 Rs/fbcAGCGCCGCAAGATCGAGCCCGACCCGCGCGAGCCGCGCTACCT89
 Rs/nirKCGCAAACTCCGGCCTCTCCAGAGGATCTACCGATCGGGTCAT7
 Rs/pucTGAATCTGTCAGCGCAATGTGACACCCATAATGCGAGCCGGGG94
 Rs/pufGATCCGCCGCGCGACGGGCACCCCCTTCATGGGTTACATGGGT151
  • a All promoters have had their transcript start sites (the last base in each sequence) determined by primer extension or S1 nuclease (∗) assays. Group A consists of promoters possessing either or both of the −10 and −35 hexamers and are ranked according to the identity of the −35 region to that of the E. coli consensus. Group B consists of promoters with a −10 region 5 to 9 bp from the transcript start site but no −35 region. The promoters in group C have RNAP binding sites that cannot be identified easily, but this does not necessarily disqualify them from ς70 RNA polymerase dependency. R. capsulatus glnB, nifA1, and nifA2 promoters are not included because they have been shown to be RpoN-dependent (82). Pd, Paracoccus denitrificans;Rc, Rhodobacter sphaeroides; Rs,Rhodobacter capsulatus; Ec, E. coli.

  • b Underlined hexamers have 50% or more identity to the appropriate E. coli consensus.