Table 5.

Promoters from the Rhodobacter group of the alpha Proteobacteria

Strain/promoteraPromoter regionbReference(s)
Ec/consensusa TTGACA N15–19TATAAT 120
Group A
Rc/bchC ATCAAATTGACAGTCGGGCGTGTAAGTTCAATGATACACACAGG 54
 Rs/groE CCCCCGTTGACAGGTGCCGGACGCTCTCATATCTCTCGCGTCG 166
 Pd/qoxA* TTGACCTAGATCAAGGTAATTCACCCCGCCATGTTGC 346
 Rc/radC GAGATCTTGACGAGGCGCAGCCGGTTGCCGTCTCTTCCGACC 197
 Rs/trxA GACAACTTGACGCGGCAGGGGGCCATCCTTACTTTCCAAGCA 222
 Rc/recA ATTTGATTGCAATGTTCCGCAATTGTACTTCATACCATGAGAA 76
 Rc/cpeA ATGCAATTGGAATTTATCAAAATCGCCTTCTAGTTTCAATCGC 81
 Rc/puc TTACACTTGATCGCCGACACTTGGGCTCCCATAGTGCGTCTCA 54
 Rc/fdxA CTGCTCTTGATTGATCGCCCCCGGAGGGCTAGGACATCCC 72,248
 Rc/atpH TGGTTGCGAGGGTCTTGATGCTCTGCTAGACGCAACCCCCGA 31
 Rs/hupS TTCTCATTGGCGGAAACCGGCCCAACCATGAGAATTCCACTCTA 288
 Rs/coxII TTTTCCTTGTCGTCGCCAAAACAATATGGTCTCAATCGGTTCA 79
 Rc/lepB TTGACTTGCCCCCCGCATCGGCCAAGGAAGACAAGGTTTCAAC 154
 Rc/dnaK CAGTTCTTGCAGGGCTATTTTCCCCTCCTTATATACGCCGG 198
 Rs/rrnB ATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAACCGCTTC 71
 Rs/rrnA TTCCTCTTGCGGGTTTTTTTGCGGTTCCCTAGATAGCGCCTC 71
 Rs/rrnC TTCCTCTTGCGGGTTTTTTTGCGGTTCCCTAGATAGCGCCTC 71
 Rc/rpoD TTTGATTCGCCCCTGTGATTCGCCGCCGTGATTCGATAAAAC 223
Group B
 Pd/sdhC ATGTGATCACAGCTGCCGTTTGCGTGATCACAAAAATGGAAA 69
 Rc/porA GGCCGCTTCGGTCCCGTTTTCGTTGCAATATGAGGCGTGG 289
 Rs/cycF TTCCAGTATGTCTGTCGCGACCGGCGGGCTAGATTTCCGGGA 79,80
 Rs/norC CCCGCAACCTCTCCGGCGCCGGCGCGGGCTAGAGGAGGTCCA 7
 Pd/ctaC* GATAGGTATGGCTTGCCGCCGGGGTAAGATATGGTTCTGGTG 277
 Pd/fbc* CCGCTGGACTGACGGGGATTTGATCGCTAGAACCGCGC 277
 Pd/porG*  ATGCGGGGGGGAAAGCGCGACACCACTTGCATACCCCAAAC 254
 Rc/pufG CTCTGGACCGGATCGTGTCGCAACACCCGGTTCTGACACGGA 11
 Rc/pufQ CGCGCGACGGGCACCCCCTTCATGGTTACATGGGTA 54
 Rs/chrR1 GCCTGATCCAGACTGGCCCGGCCGCCGTAAGAAGGACGTTA 257
 Rs/chrR2 GCGGATGCAAGCCGGGGGAGGGTTTCCTATCTTCACCTCCGG 257
 Rc/cycA ATATGCGACCTTTTGCCTTGTGGTAAAGCGTGGACCG 54,70
 Pd/pazS TTCTCAAGCCGAATGCCCTGTACCGGACCTAAACCAGGCACG 168
Group C
 Pd/cycA1 CCTGTATTCTGCCCGCTTGGCACATGATAGCCCTGTCAATCG 279
 Pd/cycA2 TCTGCCCGCTTGGCACATGATAGCCCTGTCAATCGGGAAGCG 279
 Rc/fruB TTTCGCGCGCGAACTCTGCCCCATGGGCGATGGCCG 54
 Rc/xdhA TTCAACGCGCCGCGGGCCGAAATCCTTGCCAGCGCCAAAGCC 167
 Rs/crtA GGGCGGACATTAGTCGCGAAGTCGCACCGCCCTCAAGCCGCA 164
 Rs/ctaD GGAACAAGACCGGCGTCTACAGATATCCGGGAGATGCTGGCA 79
 Rs/cycA CCGGAACGCGCGGCCCGCAGTAGTGATTGTGTGCCGGCGGCA 70
 Rs/fbcA GCGCCGCAAGATCGAGCCCGACCCGCGCGAGCCGCGCTACCT 89
 Rs/nirK CGCAAACTCCGGCCTCTCCAGAGGATCTACCGATCGGGTCAT 7
 Rs/pucT GAATCTGTCAGCGCAATGTGACACCCATAATGCGAGCCGGGG 94
 Rs/pufG ATCCGCCGCGCGACGGGCACCCCCTTCATGGGTTACATGGGT 151
  • a All promoters have had their transcript start sites (the last base in each sequence) determined by primer extension or S1 nuclease (∗) assays. Group A consists of promoters possessing either or both of the −10 and −35 hexamers and are ranked according to the identity of the −35 region to that of the E. coli consensus. Group B consists of promoters with a −10 region 5 to 9 bp from the transcript start site but no −35 region. The promoters in group C have RNAP binding sites that cannot be identified easily, but this does not necessarily disqualify them from ς70 RNA polymerase dependency. R. capsulatus glnB, nifA1, and nifA2 promoters are not included because they have been shown to be RpoN-dependent (82). Pd, Paracoccus denitrificans;Rc, Rhodobacter sphaeroides; Rs,Rhodobacter capsulatus; Ec, E. coli.

  • b Underlined hexamers have 50% or more identity to the appropriate E. coli consensus.