TABLE 4.

Intrinsic terminators mapped or predicted on the T4 genome

5′ gene3′ geneStrandStartaStem-loop-stem-poly(U)aTetraloopIdentifierb
Intergenic locations
    39.1395384GGCC UUCG GGCC TTTAGCTTTATUUCGTT, Term
    socmrh.215305GGACTCC TTCG GGAGTCC TTTTTTCATTTUUCGTT, Term
    43imm.127183GGACC TCCA GGTCC CTTTTTUCCATerm
    regA4329967GGGGC TTCG GCCCC TTATTTUUCGTT, FP
    454431912GGGC TTCG GCCC TTTATAATTTUUCGTT, FP
    a-gt4736622GGGC TTCG GCCC TTTAGCTTTUUCGTT, FP
    a-gt.2mobB38731GGAGC TTCG GCTCC TATATTGCTTTATAAATTTTTTUUCGFP
    55.355.240836GGGC TTCG GCCT TTTTUUCGFP
    nrdH55.641800GGCCC AGA GGGCC CGTCTTAATCTTCTNoneTT
    pin4946884CCCTTACCT TAAAT AGATAAGGG TATTTATTATTTTNoneTT
    nrdC.11nrdC.1055432GGGAGCC TTCG GGCTCCC TTTTTTATTTUUCGTT, Term, FP
    rI.-1mobD.558813GTCTCC TTCG GGAGAC TTTTTTTCATTTTUUCGTT, Term, FP
    vstk.461369GGGCG ATATTG CGCCC TTTTNoneTT, Term
    e.6e.569306GGGGC TTCG GCCCC TATTACTTUUCGTerm, FP
    RNA Ce.870856GCCCCGACC GAAA GGTTGGGGC TTTTTGAAATT, Term
    89+87161GGGAGCC CATG GGCTCCC TTTTTCTTTCAUGTT, Term
    wac13+93596GGGGCC GCAA GGCCCC AAAGGATTTTGCAAFP
    1920+101131GGGGA GAAA TCCCC ATCCTGCTTGAAATerm
    23segD+106537GGGAACC TTCG GGTTCCC TTTTTTCTATTTTUUCGTerm, FP
    24rnlB+108613GGGACC TTTC GGTCCC TTTTTATTTUUUCTT, Term
    24rnlB+108668GTACA TCT TGTAC CATTTTNoneTT
    hoc24.3110180GGGGC TTCG GCCCC TTTCTTCATTTTUUCGTT, Term
    uvsY.-2uvsWend114472GGCCCTTCC TTTTT GGTTGGGCT TTTTAATNoneTT, Term
    54alt.-3end+122720TGGGGACC GAAA GGTCCATA TTTTTATTTGAAATerm
    alt.1alt125558GGCC UUCG GGCC TTTAATTTTATUUCGTT, Term
    30.930.8130358GGACTCC TTCG GGAGTCC TTTTTTATTTTUUCGTT, Term
    30.930.8130402CGAGATG ATG CTTCTCG TTTTNoneTT
    nrdBdenA137950TGGGCC GCAA GGCCCA TTTTATTATGCAAFP
    nrdAmobE140384TTCCCGAGC TCAG GCTCGGGAA CCTTTATUCAGTerm
    32frd.3146925GGGACC CTAGA GGTCCC TTTTTTATTTTNoneTT, Term
    3536+155811GGGACCC TTCG GGTTCCC TTTTTCTTTUUCGTT, Term, FP
    3738+159628GGGGC TTCG GCCC TTCTUUCGFP
    tasiAend+160924CCCTCGTTGAA TTCG TCGATGAGGG TTTTCTTATCTTCTTUUCGFP, Term
    motA.1motA163724GGGAGAGC CGAG GCTCTCCC TTTTTTATTTTCGAGTT,Term
    ac52.1165332GGGCTA TTCAT TAGCCC TTGCTGCTTTATTNoneTerm
    denB.1denB167736GGGC UUCG GCCT TTTGTTTTUUCGTerm, FP
Peculiar locations or nonpoly(U)3 ′ ends
    56/segFsegF16233GACGCC GAAA GGCGTC TCTTTTGAAAFP
    uvsX-404022347CCCCCTC TTCG GAGGGGG AAGAAGAAAGAAAAGAAUUCGFP
    in 5.4ntr.c80949GCCATGTG TTT CATACGGC TTTTTAATTTNoneTerm
    5.4/66+81769TTGATG GAAA CACTGAA TTCTATTTTGAAAFP
    34/3535+154701GGCCGAGTTTGGACA AGGATA TGTCCAAACGCC ATTTTTNoneTerm
    in stpntr.+165510GGCGTC CGAA GACGCC TTTAGTTTTCGAATerm
    rIIBdenB.1167967TAAGGC TTCG GCCCTTA ACTAAGGAAAATTATGTTUUCGFP
  • a Numbered 5′ start is the first base of the RNA helix, and underlined characters are nonpaired bases.

  • b Programs that identify the terminator: FP, GCG FindPattern; Term, GCG Terminator; TT = TIGR TransTerm.

  • c ntr., nontranscribed strand.