TABLE 4.

Description of some well-studied PRD-containing antiterminators

AntiterminatorOrganismControlled gene(s)Inducer(s)RAT sequence
LicT B. subtilis bglPH β-GlucosidesGGATTGTTACTGCGAAAGCAGGCAAAACC (bglP)
bglS GGATTGTTACTGATAAAGCAGGCAAAACC (bglS)
SacT B. subtilis sacPA (sacB)aSucroseGGATTGTGACTGGTAAAGCAGGCAAGACC (sacP)
SacY B. subtilis sacB (sacPA)aSucroseGGTTTGTTACTGATAAAGCAGGCAAGACC (sacB)
sacXY GGATTGTGACTGGGCAGGCAGGCAAGACC (sacX)
GlcT B. subtilis ptsG(HI)GlucoseACGTGTTACTGATTCGATCAGGCATCAGT (glcT)
GlcT S. carnosus glcA, glcBGlucose, β-glucosidesACGTGTAACTAATTCGATTAGGCATGAGT (glcA)
BglG E. coli bglFB β-GlucosidesGGATTGTTACCGCACTAAGCGGGCAAAACC (bglF)
bglG GGATTGTTACTGCATTCGCAGGCAAAACC (bglG)
LacT L. casei lacTEGF LactoseTGGATTGTGACTATTTAATTAGGCGACC (lacT)
  • a The similarity of the RAT sequences preceding sacB and sacPA probably explains the cross talk observed with the two antiterminators SacY and SacT.