TABLE 4.

Description of some well-studied PRD-containing antiterminators

AntiterminatorOrganismControlled gene(s)Inducer(s)RAT sequence
LicTB. subtilisbglPHβ-GlucosidesGGATTGTTACTGCGAAAGCAGGCAAAACC (bglP)
bglSGGATTGTTACTGATAAAGCAGGCAAAACC (bglS)
SacTB. subtilissacPA (sacB)aSucroseGGATTGTGACTGGTAAAGCAGGCAAGACC (sacP)
SacYB. subtilissacB (sacPA)aSucroseGGTTTGTTACTGATAAAGCAGGCAAGACC (sacB)
sacXYGGATTGTGACTGGGCAGGCAGGCAAGACC (sacX)
GlcTB. subtilisptsG(HI)GlucoseACGTGTTACTGATTCGATCAGGCATCAGT (glcT)
GlcTS. carnosusglcA, glcBGlucose, β-glucosidesACGTGTAACTAATTCGATTAGGCATGAGT (glcA)
BglGE. colibglFBβ-GlucosidesGGATTGTTACCGCACTAAGCGGGCAAAACC (bglF)
bglGGGATTGTTACTGCATTCGCAGGCAAAACC (bglG)
LacTL. caseilacTEGFLactoseTGGATTGTGACTATTTAATTAGGCGACC (lacT)
  • a The similarity of the RAT sequences preceding sacB and sacPA probably explains the cross talk observed with the two antiterminators SacY and SacT.